Genetics Info
 
Home

Blog | Forum

Articles

Bookmark This Page

 
CATEGORIES

Genetics

Stem Cell Research

DNA

Gene Therapy

Genetic Testing

Genetic Engineering

Genomes

Chromosomes

Cloning

Genetic Research

Genetic Modification
   

 

DNA Double Helix


















 

  
Dna Technology
Dna
Cost Of Dna Testing
Dna Activation
Dna Cloning
Dna Database
Dna Double Helix
Dna Evidence
Dna Extraction
Dna Fingerprinting
Dna Forensics
Dna Genealogy
Dna Information
Dna Internet
Dna Lab
Dna Model
Dna Molecule
Dna Paternity
Dna Paternity Test
Dna Paternity Testing
Dna Pattern
Dna Process
Dna Profiling
Dna Project
Dna Repair
Dna Replication
Dna Research
Dna Rna
Dna Sequence
Dna Sequencing
Dna Structure
Dna Test
Dna Test Kit
Dna Transcription
Dna Translation
Dna Workshop
Forensic Dna
Human Dna
Mitochondrial Dna
Recombinant Dna
Recombinant Dna Technology

  • Womens Plus Size Expansion
    There is some fantastic news that all you plus size women should know. Evidence is showing that more and more companies, clothing stores and merchandisers are opening their eyes, to accommodate larger sizes.

    Within the past, the Gap is one of the industry leaders and has extended their sizes, currently only available online at www.gap.com, to include XXL and sizes up to 20. Although this only covers a few sizes in the plus size range, it is a start and it is coming from a clothing store everyone is familiar with.

    Now it is becoming a reality that women with plus size needs can ...
    Author:     Bowe Packer
    CLICK HERE TO READ THE REST OF THIS ARTICLE


    Additional Navigation:

    Genetics: 1 2 3 4 5

    Engineering

    Diseases

    Genetic Testing

    DNA Testing 1

    Genomes

    Gene Therapy 1

    RNA 1

    Chromosomes

    Cloning 1 2 3

    Misc

    Stem Cells 1 2

     

    		•

    		 
    Today's Featured Articles:

  • Movie Review - Cellular
    Cellular - 2005 New Line Productions Inc.

    I had a chance to watch Cellular the other day and my first thought was that here we go with another spin-off of Phone Booth, another movie with someone forced to stay on the phone for 90 some minutes while we cringe in our seat. But, to my surprise , this was actually a very enjoyable movie. I’m am not really sure what genre to classify this movie in because it has it all. Suspense, drama, action, comic relief; this movie has everything.
    The movie begins with the kidnapping of Jessica Martin, played by Kim Bassinger.
    Jessica is a high sch ...
    Author:     Reggie Bannister
    CLICK HERE TO READ THE REST OF THIS ARTICLE

  • DNA, Fiction and Society; How it Affects Thought

    A book called the Seven Daughters of Eve by Richard Sykes is worthy of a read and talks about what we have learned about the flow of human beings populations through DNA research. Thus it is safe to say that certain members of our species have developed differently and in different ways, meaning the brain also learns differently. As Scientists look at different human brains while doing various tasks and watch which areas light up with energy as it works through these different thoughts and tasks we are finding just how unique and different each mind really is.

    Yet as we learn more abo ...
    Author: Lance Winslow
    CLICK HERE TO READ THE REST OF THIS ARTICLE

    Want to read more of our articles?  Check out the Archive.

    Article Archive: Pages 1 2 3 4 5 6 7 8 9 10 11 12 13

     

    		•

     
    Genetics News:

    Scientists sequence DNA of woolly mammoth
    A team of experts in ancient DNA from McMaster University (Canada) and genome researchers from Penn State University (USA) have obtained the first genomic sequences from a woolly mammoth, a mammal that roamed grassy plains of the Northern Hemisphere until it became extinct about 10,000 years ago. The project also involved paleontologists from the American Museum of Natural History and researchers from Russia, the United Kingdom, France, and Germany.


    Scientists Sequence DNA Of Woolly Mammoth
    Experts in ancient DNA from McMaster University (Canada) have teamed up with genome researchers from Penn State University (USA) for the investigation of permafrost bone samples from Siberia. The project also involved paleontologists from the American Museum of Natural History (USA) and researchers from Russia, the United Kingdom, France, and Germany... click link for more info.


    Sequential addition of short dna oligos in dna-polymerase-based synthesis reactions
    A method of fabricating a DNA molecule of user-defined sequence. The method comprises the steps of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one...


    Sequence-Specific DNA Recognition by Monomeric bZIP Basic Regions Equipped with a Tripyrrole Unit on the N-Terminal Side. Towards the Development of Synthetic Mimics of Skn-1.
    Publication Date: 2005 Dec 2 PMID: 16231291Authors: Blanco, J. B. - Vazquez, M. E. - Castedo, L. - Mascarenas, J. L.Journal: Chembiochem


    Mitochondrial DNA-Sequence Database published
    Researchers from Newcastle University and other institutions have sequenced mitochondrial DNA from 500 ethnically diverse individuals. The data may shed new light on a variety of diseases.


    Second Non-human Primate Genome Assembled - Rhesus Macaque DNA Sequence Available In Free, Public Databases
    A multi-center team has deposited the draft genome sequence of the rhesus macaque monkey into free public databases for use by the worldwide research community, the National Human Genome Research Institute (NHGRI), one of the National Institutes of Health (NIH), announced today. The rhesus macaque (Macaca mulatta) is the second non-human primate, after the chimpanzee (Pan troglodytes), to have its genome sequenced, and is the first of the Old World monkeys to have its DNA ... click link for more info.


     
    		 
     


  • Treating Chronic Mutational Hepatitis B with Chinese Medicine Vitalliver (Vigconic Suppositories)

    Research Method:

    Quantitative determination by contrasting HBV-DNA of cases before and after the treatment.

    Number of cases: 25 (n)

    Case Selection: Between the age of 16 and 65, in accordance with the diagnosis standards pf chronic Hepatitis B, with negative e antigen and positive e antibody, HBV-DNA > 1×104 cp/mL.

    Detection Method: All the blood samples are detected by Sichuan Clinical Detection Center; PCR-ELISA quantitative determination is used within detection range of 1×104 - 1×107-8, HBV-DNA, unit of measurement is cp/mL.

    Direction Plan: one suppository ...
    Author: Zhang Guan Hua
    CLICK HERE TO READ THE REST OF THIS ARTICLE

    Here are a few more sites I've chosen if you'd like to read more and do more research:

  • Analyzing DNA sequence data
    Analyzing EST DNA sequence data Instructions: 1-6 Preparing the Sequence. 7-9 What's your gene? Tools: NCBI BLAST Entrez DNA Tools WebGen Others


  • Microarray Design
    http://tiling.gersteinlab.org/



  • ... edu 212-327-8575 Journal of Experimental Medicine Viral DNA sequence a possible trigger for breast cancer A small sequence of DNA in the envelope (Env) protein of a mouse breast tumor virus (called ...


  • Sequence Massager
    Nucleic Acid Sequence Massager [^\n]*\n/g,'').replace(/>[^\r]*\r/g,'')"> ]*>/g,'')"> Find text matching this regular expression: ... and replace it with this character string:


  • DNA Sequence Alignments
    DNA Sequence A lignments and Data M atrices This page presents several data matrices and DNA sequence alignments published or presented by staff and collaborators of the Lewis B. and Dorothy Cullman ...


  • DNA Sequence
    DNA sequence The relative order of base pairs, whether in a fragment of DNA, a gene, a chromosome ... ... Selected DNA sequence links: © 2004 TheBioTechDictionary.com. If you have comments or additions ...


  • NEWS FROM THE HOSPITAL FOR SICK CHILDREN
    ... m. EDT DNA sequence of chromosome 7 decoded - Canadian-led project generates database with medical annotation available to the public TORONTO - Scientists at The Hospital for Sick Children (HSC) have ...


  • ISU DNA Sequence and Synthesis Facility Homepage
    We've moved our website to http://www.dna.iastate.edu


  • Sequence - Directed DNA Curvature. Wedge Model Formalism and DNA Path Comput...
    Sequence - Directed DNA Curvature. Wedge Model Formalism and DNA Path Computation. Full documentation on this program (on-line and non-online versions) is here To download non-online version in .zip ...


  • Generation of a Species-Specific DNA Sequence Library of British Mammals
    ... Topics> Publications catalogue> Species> Mammals> Generation of a Species-Specific DNA Sequence Library of British Mammals Topics Site Map Search Publications catalogue Corporate JNCC ...


  • DNA SEQUENCING FACILITY
    ... This equipment provides a rapid and inexpensive method for deriving DNA sequence from both cloned DNA inserts and PCR fragments. 377XL sequencing chemistries: Four types of sequencing chemistry are ...



  • http://www.ba.cnr.it/Embnetut/Gcg/index.html


  • Birds:Sibley's List index (Non Passeriformes)
    ... Storm-Petrels 7/21 Passeriformes Sibley's Sequence Lista degli uccelli del mondo by Charles G ... ... Living Birdsby Dr. Charles G. Sibley- -- The Yale DNA Hybridization Scandal: Introduction © Picchio ...



  • DNA sequence A DNA sequence is a succession of letters representing the primary structure of a real or hypothetical DNA molecule or strand. The possible letters are A, C,G, and T, representing the ...


  • The MathWorks - MATLAB News & Notes - May 2003 - Studying Web-Based DNA ...
    ... sales E-mail this page Print this page Newsletters - MATLAB News & Notes Studying Web-Based DNA Sequence Data Directly from MATLAB by Rob Henson March 2003 marks the 50th anniversary of perhaps the ...


  • UCSF Sequence Analysis and Consulting Service HomePage
    Located at MISSION BAY CAMPUS Consulting | Training | Resources | Documentation | Links | Contact ...


  • pShuttle DNA Sequence
    pShuttle-CMV Sequence NNNTTAATTAANNNTCCCTTCCAGCTCTCTGCCCCTTTTGGATTGAAGCCAATATGATAATGAGGGGGTGG AGTTTGTGACGTGGCGCGGGGCGTGGGAACGGGGCGGGTGACGTAGTAGTGTGGCGGAAGTGTGATGTTGC ...


  • CM sequence designation
    ... found in this published sequence and so HAW is not assigned here. 2 Cited in Chassin-Noria et al. 2004 REFERENCES Norman, JA, C Moritz, and CJ Limpus. 1994. Mitochondrial DNA control region ...


  • Translate a DNA Sequence
    Molecular Toolkit Index Toolkit Help Translate a DNA Sequence Overview Input a nucleic acid ... ... Instructions Enter or paste a DNA (or RNA) sequence into the upper text box, then click the ...


  • Hartwell Center/Applications and Research Tools/DNA/Protein Sequence Analysis
    ... emulation) The Staden Package is a software package to perform most aspects of sequence analysis including DNA assembly, sequence analysis, sequence comparisons, library handling and searching ...


  • Scientists Unravel Chimpanzee DNA Sequence
    ... to Fly Gallery: Dinosaur Fossils Gallery: Invasive Species Scientists Unravel Chimpanzee DNA Sequence By Malcolm Ritter Associated Press posted: 31 August 2005 02:03 pm ET NEW YORK (AP ...


  • dna sequence - info 24
    dna sequence a the is that measure The particular eczema photo construction estimating software real estate leasing apples to apples game web design template drafting schools ntn bearing low blood ...


  • DNA Sequence Utility Released From Mek & Tosj || The Mac Observer
    ... Skip navigational links Home Features Archives Reader Specials Forums Search Contact RSS Choose text size: DNA Sequence Utility Released From Mek & Tosj by Staff , 4:00 PM EST, February 9th, 2004 Mek ...


  • dna sequence - info123
    dna sequence fibonacci A free database application includes a editor, several aligners, phylogeny escape for molecular alignment, phylogenetic assembly and proof-reading dna hybridisation a protein ...


  • NOVA Online | Cracking the Code of Life | Sequence for Yourself
    Go to "Sequence for Yourself" Flash required Sequence for Yourself by Rick Groleau A single DNA ... ... Rather, it makes billions of identical copies of a small sequence of DNA -- enough copies to allow ...


  • Unique Sequence & Translocation DNA Probes for Oncology / Pathology
    ... 17 Probe Cocktail, Dual-Colour 10 PONC6CLL CLL Probe Panel (6 probes) 10 PONC1213 Unique Sequence 12q13 DNA Probe (GLI3) - Red 10 PONC0722 Unique Sequence 7q22 DNA Probe - Red 10 PONC0735 Unique ...


  • Facilities: DNA Sequencing Lab
    ... Home About us Events Research Facilities Overview Appendiculia Zebrafish Cnidaria DNA Sequence Vessels and Marine Stations Education Join Us Personnel Contact Bergen Facility Staff Bianca NygÂrd ...


  • Putting DNA to Work - DNA Sequence - Introduction
    DNA Home Introduction DNA Sequence Inherited Diseases DNA/Criminal Justice Improving Crops Infectious Disease DNA SEQUENCE Introduction 1 2 3 4 5 The DNA Sequence The extremely long DNA molecule is ...


  • EnergyStorm - The Dna Sequence And Biology Of Human Chromosome 19
    Home About Us Contact Us Biology And Medicine Basic Biological Sciences The Dna Sequence And Biology Of Human Chromosome 19 Authors: Grimwood, J ; Gordon, L A ; Olsen, A ; Terry, A ; Schmutz, J ...


  • 1996.04.24 : International Team Completes DNA Sequence of Yeast
    ... 301-402-0911 and Linda Sage Washington University 314-286-0119 International Team Completes DNA Sequence of Yeast An international consortium of scientists announced today it has finished spelling ...


  • BioTrove : Products & Services : OpenArray Transcript Analysis System
    Home : Scientific Papers : Support : Contact Products & Services : OpenArray Transcript Analysis ...


  • Specific local histone-DNA sequence contacts facilitate high-affinity, non-c...
    Specific local histone-DNA sequence contacts facilitate high-affinity, non-cooperative nucleosome binding of both adf-1 and GAGA factor. Nucleic Acids Res 1998 Dec 1;26(23):5394-401 Gao J, Benyajati ...


    •

  • The Truth About Halitosis, More Commonly Known As Bad Breath
    PART I: THE SCIENCE OF HALITOSIS AND BACTERIA IN YOUR MOUTH

    Halitosis, also more commonly known as bad breath, is caused by anaerobic producing bacteria which normally live WITHIN the surface of the tongue and in the throat. These bacteria are supposed to be there because they assist with digestion by breaking down proteins found in specific foods, mucous or phlegm, blood, and in diseased or "broken-down" oral tissue. Under certain conditions, these bacteria start to break down proteins at a very high rate. Proteins are made up of amino acids, two of which (Cysteine and Methionine) are dens ...
    Author: Dr. Harold Katz - TheraBreath
    CLICK HERE TO READ THE REST OF THIS ARTICLE

     

  • Hot Women And Eye Contact

    For a while now I've been wondering why some women always make eye contact and hold it longer than others, and in most cases, the women who fail to maintain eye contact are the best looking. Each woman is unique, so their reasons for not maintaining eye contact could be any of a variety of things. However, after a lot of thought and research I've found out why these "dimes" or perfect 10's tend to make eye contact much less than other women. Read on and be enlightened.

    Like I said before... they do this for a variety of reasons, but a few shine through the rest. The majority of these ...
    Author: Kris Player
    CLICK HERE TO READ THE REST OF THIS ARTICLE

     

     

     

    		•
             
        Copyright Genetics Info 2005-2006    

    Partners & Resources