Genetics Info
 
Home

Blog | Forum

Articles

Bookmark This Page

 
CATEGORIES

Genetics

Stem Cell Research

DNA

Gene Therapy

Genetic Testing

Genetic Engineering

Genomes

Chromosomes

Cloning

Genetic Research

Genetic Modification
   

 

DNA Double Helix


















 

  
Chromosomes
Chromosome 1
Chromosome 10
Chromosome 11
Chromosome 12
Chromosome 13
Chromosome 14
Chromosome 15
Chromosome 16
Chromosome 17
Chromosome 18
Chromosome 19
Chromosome 2
Chromosome 20
Chromosome 21
Chromosome 22
Chromosome 23
Chromosome 3
Chromosome 4
Chromosome 4p Syndrome
Chromosome 5
Chromosome 6
Chromosome 7
Chromosome 8
Chromosome 9
Chromosome Abnormality
Chromosome Band
Chromosome Deletion
Chromosome Disorder
Chromosome Map
Chromosome Marker
Chromosome Metaphase
Chromosome Translocation
Chromosome Walking
Female Chromosome
Fragile X Chromosome
Homologous Chromosome
Male Chromosome
X Chromosome
X Chromosome Inactivation
Xxy Chromosome
Y Chromosome

  • A Glossary Of Penis Enlargement Terms - Part I
    Anatomy Of The Penis
    See Corpora Cavernosa and Corpus Spongisum below.

    Corpora Cavernosa
    Two chambers located either side of the Corpus Spongisum with the rich network of blood vessels that supply blood to the enis. When aroused, the blood vessels of the Corpora Cavernosa are flooded with extra blood, which in turn causes the penis to become hard and erect. Penis enlargement programs and devices work by encouraging the growth the blood vessels of the Corpora Cavernosa so that they are able to hold increased amounts of blood.

    Author:     Ami Steel
    CLICK HERE TO READ THE REST OF THIS ARTICLE


    Additional Navigation:

    Genetics: 1 2 3 4 5

    Engineering

    Diseases

    Genetic Testing

    DNA Testing 1

    Genomes

    Gene Therapy 1

    RNA 1

    Chromosomes

    Cloning 1 2 3

    Misc

    Stem Cells 1 2

     

    		•

    		 
    Today's Featured Articles:

  • Facts about Genetic research

    Genetics, or the science of genes, seems to be the future of modern medicine, and genetic research keeps gaining ground, but together with the great benefits and cures it can bring, genetic research poses a lot of moral and ethical problems, and it has been said that it could even threaten our civil rights and liberties.

    If genetic research continues to develop, parents will be able to have exactly the children they want, and they could plan his life even before his birth. And is this 'right'?Other thing that genetic research could lead to is genetic discrimination - already a numbe ...
    Author:     David C Skul
    CLICK HERE TO READ THE REST OF THIS ARTICLE

  • Bodyguard Training in Mexico; My Experiences While Providing BG Training in Mexico

    Mexico the country of Salsa, Tortillas and Corruption; I first arrived in Mexico City in February 2002 as an instructor for the WFB – the World Federation of Bodyguards. A Mexican security service had contracted Anders Sorenson, the Norwegian WFB instructor and I, to set-up a training program for BG’s in Mexico.

    I came through customs and the weapons search, shaking my head at the Mexican officials who only spoke Spanish, making my visa interview a complete waste of time.

    That was one of my first lessons about Mexico; almost all Mexicans dream of going to the US to live however, ...
    Author: Dan Sommer
    CLICK HERE TO READ THE REST OF THIS ARTICLE

    Want to read more of our articles?  Check out the Archive.

    Article Archive: Pages 1 2 3 4 5 6 7 8 9 10 11 12 13

     

    		•

     
    Genetics News:

    The Chromosome 7 Annotation Project
    The Chromosome 7 database is a community-curated project which contains the most up to date collation of sequence, gene, and other annotations from all databases (eg. Celera published, NCBI, Ensembl, RIKEN, UCSC) as well as unpublished data.


    Y Chromosome May Not Be Doomed
    The human Y chromosome -- the DNA chunk that makes a man a man -- has lost so many genes over evolutionary time that some scientists have suspected it might disappear in 10 million years. But a new study says it'll stick around. By Associated Press


    Secreted proteins encoded by human chromosome 13
    The present invention relates to polynucleotide and polypeptide molecules a for zsig46 polypeptide, a novel secreted protein located on human chromosome 13. The zsig46 polypeptides, and polynucleotides encoding them, are secreted proteins and may be used in the study of receptors for which a ligand has not yet been identified,...


    US-India research team completes analysis of X chromosome
    By intensely and systematically comparing the human X chromosome to genetic information from chimpanzees, rats and mice, a team of scientists from the United States and India has uncovered dozens of new genes, ...


     
    		 
     


  • Validating Form Input in JavaScript
    This time we'll make a form that collects information about the
    visitor at your site. You must have filled-in copious
    registration forms or survey forms where you had to enter your
    name, your email, your address, etc. Sometimes users,
    intentionally or unintentionally, enter wrong information that
    can either spoil your database scheme or give you lots of useless
    data and hence, waste your precious server space.

    To avoid such problems, as much as it can be managed, we
    programmatically try to make sure, that data is entered in an
    orderly fashion, and no unusable fie ...
    Author:     Amrit Hallan
    CLICK HERE TO READ THE REST OF THIS ARTICLE

    Here are a few more sites I've chosen if you'd like to read more and do more research:

  • ABOUT
    ... One parkinson gene is on Chromosome-4 which codes for the protein alpha-synnuclein. Another parkinson gene is on Chromosome-6 which codes for the protein parkinson. The function of both proteins ...


  • Mapping Fate
    ... The HD gene was named IT15, for Interesting Transcript, and lies at the tip of chromosome 4. Its protein was termed huntingtin. Normal genes produce a protein with roughly 11 to 33 repeats of the ...



  • chromosome 4 infobiogen Launchpad ncbi Genethon1996 Genenome1996 Genenome1993 NIH/CEPH1992 ensembl ... ... html Specialty Laboratories 4 Welcome If you have a phenotypic variation related to this chromosome ...


  • chromosome 4
    Code NCBI Code AFM Bande cytogÈnÈtique sexe-ratio (cM) Femelle (cM) Mle (cM) D4S2983 AFM265yh5 ...


  • TJL BSB/BSS Chromosome Maps
    ... for a Chromosome, select the desired Chromosome below: Chromosome 1 Chromosome 2 Chromosome 3 Chromosome 4 Chromosome 5 Chromosome 6 Chromosome 7 Chromosome 8 Chromosome 9 Chromosome 10 Chromosome 11 ...


  • FlySci.com: Genome by Matt Ridley: Chromosome 4: Fate
    ... 1234 56 78 910 1112 1314 1516 1718 1920 2122 X and Y Chromosome 4: Fate Chapter 4 of "Genome", entitled Fate, generally tells us that our genes determine our fate. In the beginning of the chapter ...


  • http://www.anex.med.tokushima-u.ac.jp/rat/sslp/c4/chrom4.html
    Chromosome 4 markers Click each markers, then you can see the electrophretic pattern on the MetaPhor agaros e gels. You may find several numbers of same marker names, but their markers were typed ...



  • ... Chromosome 4 Chromosome Statistics TIDBase Home> Human> Chromosome 4 Organism: Human Mouse Rat Tools: Connect the Dots Gbrowse Beta Cell Gene Bank DIL Gene Browser Strain Information Cytoscape ...


  • T1DBase - Human Chromosome 4
    ... T1DBase Home> Human> Chromosome 4 Organism: Human Mouse Rat Tools: Beta Cell Gene Bank My T1DBase Microarray Connect the Dots Tissue Expression Cytoscape GBrowse GESTALT Strain Information Kegg ...


  • paper: Mapping of quantitative trait loci on porcine chromosome 4
    Home Search Citation Tree Display Graphic Display Bibliography Help paper: Mapping of quantitative trait loci on porcine chromosome 4 PubMed Mapping of quantitative trait loci on porcine chromosome 4 ...


  • Site-specific cleavage of human chromosome-4 mediated by triple-helix formation
    Site-specific cleavage of human chromosome-4 mediated by triple-helix formation. S. A. Strobel, L. A. Doucettestamm, L. Riba, D. E. Housman and P. B. Dervan Science, 254, 1639-1642, (1991). Direct ...


  • Ensembl v33: Danio rerio Overview of Chromosome 4
    ... e.g. 21, 4 Ensembl v33 - Sep 2005 Help Chromosome 4 View Chromosome 4 Map your data onto this chromosome Use Ensembl to... Run a BLAST search Search Ensembl Data mining [BioMart] Upload your own data ...



  • ... Finder Intron Finder CAPS Designer Bulk Download Unigene & BAC Information Access FTP site Chromosome 4 (Click on one of the sidebars to view that region in detail) SGN is supported in part by the ...


  • Human Chromsome 4 and Mouse Chromosome 5
    [Home] [Help] Human chromosome 4 Mouse chromosome 5 Select other chromosomes Human Mouse 1 1 2 2 3 3 4 4 5 5 6 6 7 7 8 8 9 9 10 10 11 11 12 12 13 13 14 14 15 15 16 16 17 17 18 18 19 19 20 21 22


  • Functional Genomics of Plant Polyploids
    ... This microarray has 2000 1kb features from around the heterochromatic knob on chromosome 4, (http://www.cshl.org/protarab). It has been hybridized to 21 BAC clones from this portion of the chromosome ...


  • Chromosome 4
    Chromosome 4 Chr Position in a YAC physical map (genetic distance, cM) Marker name 1) Type of marker 2) Enzyme 3) Amplified band size (bp) in Nipponbare 5' primer sequence 3' primer sequence Mapping ...


  • Albumin
    ... H., et al (Genome Research 9: 581-587, 1999) have mapped the q11-q13 region of human chromosome 4 and redefined the order and transcriptional orientations of the four genes of the albumin superfamily ...


  • Sequence and analysis of chromosome 4 of the plant Arabidopsis thaliana
    http://www.nature.com/cgi ...full/402769a0_fs.html


  • http://www.flybase.org/seqs/lk/genomic/dmel-4-chromosome-r4.2.1.fasta
    >4 type=chromosome; loc=4:1..1281640; ID=4; release=r4.2.1; species=dmel GAATTCGCGTCCGCTTACCCATGTGCCTGTGGATGCCGAACAGGAGGCGC CGTTGACGGCGAATGACTTACTCAAGGGAGTAGCCAATCTGTCGGATACG ...


  • The Human Genome (first draft) - Chromosome 4
    Chromosome 4 Back to Chromosomes page Diseases Associated with Chromosome 4 HUNTINGTON DISEASE - is an inherited, degenerative neurological disease that leads to dementia. The HD gene, whose mutation ...


  • Current Medical Diagnosis & Treatment in Psychiatry
    ... Using these techniques, researchers have located genes, in specific regions of chromosomes, for many neuropsychiatric diseases: Huntingtons disease (chromosome 4), Friedreichs ataxia (chromosome 9 ...


  • Markers and Genes mapped on Chromosome 4
    Markers and Genes mapped on Chromosome 4 Last Update : 22th May, 2002 List of genes mapped on SSC 4, (List with links to GDB in US, or GDB in Germany). List of markers mapped on SSC 4 Chromosomal ...


  • Mesothelioma-Advisory.com - lawyer, attorney, law, lawsuit -
    http://www.mesothelioma-advisory.com/


  • Malaria IDC Database
    ... mitochondrial organellar translation Go to Chromosome Chromosome 1 Chromosome 2 Chromosome 3 Chromosome 4 Chromosome 5 Chromosome 6 Chromosome 7 Chromosome 8 Chromosome 9 Chromosome 10 Chromosome 11 ...


  • © The Centre for Genetics Education
    ... The FGFR3 gene is found on the short arm of chromosome 4. There is no cure for achondroplasia but symptoms are treated as they arise. 2. Short-trunk conditions Other skeletal dysplasias result in a ...


  • Resources for Chromosome 4 Narcolepsy
    Sponsored Links for chromosome 4 narcolepsy Who Else Wants to Discover the Secrets to a Perfect ... ... Chromosome 4 Narcolepsy Resources Additional Chromosome 4 Narcolepsy Resources Page: [1] [2] [3] [4 ...


  • Related Disorders
    ... SOFT. Chromosome 1 Charlene Jurysta 114 Whitetail Lane Butler PA 16001-0268 Phone: (724) 865-2397 Chromosome 4 Christine Kleimola 1109 Sherman Street Ypsilanti, MI 48197 Phone: (734) 482-4027 Email ...



  • CHROMOSOME 4 Return to Chromosome Maps Return to Genome Mapping Data Page Return to home page


  • ENSmutants | Mouse Line Dab1
    ... 6 34.2 cM See Also At the Jackson Site: JAX Stock 002043 Disabled homolog 1 (Drosophila) (Dab1) on chromosome 4 cM 52.7 Any links immediately below search for related mouse lines on this site, or ...


    •

  • Magnetic Energy and DNA
    Magnetic energy has been in use for reducing pain and for normalizing body functions for hundreds of years. Recently a new technology has emerged that will move the magnetic healing fields in a new direction. This technology is called the Smart Magnet.

    The Smart Magnet is an ingenious device, the size of a quarter, which has certain magnetic frequencies programmed into its magnetic pattern. The imprinted frequencies are designed to help a specific area of the body. When these magnets are held close to your skin your DNA picks up this magnetic energy.

    The body needs energy to work ...
    Author:     Rudy Silva
    CLICK HERE TO READ THE REST OF THIS ARTICLE

     

  • The future of the Human Species - Part 3: How do we engineer an Earth-like environment?
    The process of making an unearthly world more earth-like for the purpose of supporting human life is called teraforming - Steven Wintergerst.

    Teraforming Mars is the only way we, humans can live and reproduce thus starting all over again on the red planet. As stated above, teraforming transforms any world unlike Earth into an inhabitable place for humans. Of course we cannot convert another planet, Mars for example, 100% into Earth. However Mars must resemble Earth in the following aspects:
    1.Thicken the small existing atmosphere and make it comprise the important gases required for ...
    Author:     K.A.Cassimally
    CLICK HERE TO READ THE REST OF THIS ARTICLE

     

     

     

    		•
             
        Copyright Genetics Info 2005-2006    

    Partners & Resources