Genetics Info
 
Home

Blog | Forum

Articles

Bookmark This Page

 


CATEGORIES

Genetics

Stem Cell Research

DNA

Gene Therapy

Genetic Testing

Genetic Engineering

Genomes

Chromosomes

Cloning

Genetic Research

Genetic Modification


   

 

DNA Double Helix


















 

 
Chromosomes
Chromosome 1
Chromosome 10
Chromosome 11
Chromosome 12
Chromosome 13
Chromosome 14
Chromosome 15
Chromosome 16
Chromosome 17
Chromosome 18
Chromosome 19
Chromosome 2
Chromosome 20
Chromosome 21
Chromosome 22
Chromosome 23
Chromosome 3
Chromosome 4
Chromosome 4p Syndrome
Chromosome 5
Chromosome 6
Chromosome 7
Chromosome 8
Chromosome 9
Chromosome Abnormality
Chromosome Band
Chromosome Deletion
Chromosome Disorder
Chromosome Map
Chromosome Marker
Chromosome Metaphase
Chromosome Translocation
Chromosome Walking
Female Chromosome
Fragile X Chromosome
Homologous Chromosome
Male Chromosome
X Chromosome
X Chromosome Inactivation
Xxy Chromosome
Y Chromosome

  • Simple Tips for Easy Weight Loss, Part I
    Copyright 2005 Monique Hawkins

    Current statistics reveal that 75% of Americans are overweight and 40% are obese. For those who desire to lose weight and obtain optimal health, sometimes it can be overwhelming trying to figure out where to start. From the Atkins Diet to the South Beach Diet; from the low fat to low carb diets, there are numerous weight-loss plans to choose from. In addition, given conflicting information as to what works best, it can be difficult deciding what to do. The following tips and information highlight's Kevin Trudeau's book: "How to Lose 30 Pounds in 30 Days: T ...
    Author:
    monique hawkins
    CLICK HERE TO READ THE REST OF THIS ARTICLE



    Additional Navigation:

    Genetics: 1 2 3 4 5

    Engineering

    Diseases

    Genetic Testing

    DNA Testing 1

    Genomes

    Gene Therapy 1

    RNA 1

    Chromosomes

    Cloning 1 2 3

    Misc

    Stem Cells 1 2

     

  •  
    Today's Featured Articles:

  • Obesity in America -- The Growing Epidemic!

    Obesity is a disease that affects approximately 60 million people in the United States, where women are especially affected. Over one-third of women between the ages of 20 and 74 are obese, the majority of them being African American or Mexican American. With more and more pre-packaged food and less and less activity, the number of obese people in America has steadily increased since the 1960’s.

    But what is obesity? Many people think obesity means that a person is overweight, but that’s not exactly true. An overweight person has a surplus amount of weight that includes muscle, bone, f ...
    Author: Shelley Hitz
    CLICK HERE TO READ THE REST OF THIS ARTICLE

  • Carb Crazed

    Low Carb diets have become as popular as apple pie (although apple pie wouldn’t be allowed!). Everywhere you go the message is “low carb, decrease your carbs, or no carbs”. Unfortunately this message oversimplifies many of the healthy eating habits that nutrition experts have been teaching. The truth is, there are no quick fixes or easy answers when it comes to healthy eating, and one size never fits all.

    The idea that carbohydrates are bad or unhealthy is a misunderstood message that has taken over our thoughts on good nutrition. Low carbohydrate promoters push the theory that carboh ...
    Author: Meri Raffetto
    CLICK HERE TO READ THE REST OF THIS ARTICLE

    Want to read more of our articles?  Check out the Archive.

    Article Archive: Pages 1 2 3 4 5 6 7 8 9 10 11 12 13

     

  •  

    Genetics News:

    The Chromosome 7 Annotation Project
    The Chromosome 7 database is a community-curated project which contains the most up to date collation of sequence, gene, and other annotations from all databases (eg. Celera published, NCBI, Ensembl, RIKEN, UCSC) as well as unpublished data.


    Y Chromosome May Not Be Doomed
    The human Y chromosome -- the DNA chunk that makes a man a man -- has lost so many genes over evolutionary time that some scientists have suspected it might disappear in 10 million years. But a new study says it'll stick around. By Associated Press


    Secreted proteins encoded by human chromosome 13
    The present invention relates to polynucleotide and polypeptide molecules a for zsig46 polypeptide, a novel secreted protein located on human chromosome 13. The zsig46 polypeptides, and polynucleotides encoding them, are secreted proteins and may be used in the study of receptors for which a ligand has not yet been identified,...


    US-India research team completes analysis of X chromosome
    By intensely and systematically comparing the human X chromosome to genetic information from chimpanzees, rats and mice, a team of scientists from the United States and India has uncovered dozens of new genes, ...


     

     
     


  • Enough is Enough
    The largest issue in our country today is not being addressed by either Republicans or by Democrats. I love my children and I want to do my part to ensure they grow up in the best country in the world. Voters need to become informed about the irresponsible government spending explosion and vote these politicians out of office.

    Our current politicians are not acting responsibly. When George W. Bush took office four years ago the federal government was over 5.6 trillion dollars in debt. Today the federal government is over 7.4 trillion dollars in debt. The debt has grown 1.8 trillion doll ...
    Author:
    Mike Sylvester
    CLICK HERE TO READ THE REST OF THIS ARTICLE

    Here are a few more sites I've chosen if you'd like to read more and do more research:

  • ABOUT
    ... One parkinson gene is on Chromosome-4 which codes for the protein alpha-synnuclein. Another parkinson gene is on Chromosome-6 which codes for the protein parkinson. The function of both proteins ...


  • Mapping Fate
    ... The HD gene was named IT15, for Interesting Transcript, and lies at the tip of chromosome 4. Its protein was termed huntingtin. Normal genes produce a protein with roughly 11 to 33 repeats of the ...



  • chromosome 4 infobiogen Launchpad ncbi Genethon1996 Genenome1996 Genenome1993 NIH/CEPH1992 ensembl ... ... html Specialty Laboratories 4 Welcome If you have a phenotypic variation related to this chromosome ...


  • chromosome 4
    Code NCBI Code AFM Bande cytogÈnÈtique sexe-ratio (cM) Femelle (cM) Mle (cM) D4S2983 AFM265yh5 ...


  • TJL BSB/BSS Chromosome Maps
    ... for a Chromosome, select the desired Chromosome below: Chromosome 1 Chromosome 2 Chromosome 3 Chromosome 4 Chromosome 5 Chromosome 6 Chromosome 7 Chromosome 8 Chromosome 9 Chromosome 10 Chromosome 11 ...


  • FlySci.com: Genome by Matt Ridley: Chromosome 4: Fate
    ... 1234 56 78 910 1112 1314 1516 1718 1920 2122 X and Y Chromosome 4: Fate Chapter 4 of "Genome", entitled Fate, generally tells us that our genes determine our fate. In the beginning of the chapter ...


  • http://www.anex.med.tokushima-u.ac.jp/rat/sslp/c4/chrom4.html
    Chromosome 4 markers Click each markers, then you can see the electrophretic pattern on the MetaPhor agaros e gels. You may find several numbers of same marker names, but their markers were typed ...



  • ... Chromosome 4 Chromosome Statistics TIDBase Home> Human> Chromosome 4 Organism: Human Mouse Rat Tools: Connect the Dots Gbrowse Beta Cell Gene Bank DIL Gene Browser Strain Information Cytoscape ...


  • T1DBase - Human Chromosome 4
    ... T1DBase Home> Human> Chromosome 4 Organism: Human Mouse Rat Tools: Beta Cell Gene Bank My T1DBase Microarray Connect the Dots Tissue Expression Cytoscape GBrowse GESTALT Strain Information Kegg ...


  • paper: Mapping of quantitative trait loci on porcine chromosome 4
    Home Search Citation Tree Display Graphic Display Bibliography Help paper: Mapping of quantitative trait loci on porcine chromosome 4 PubMed Mapping of quantitative trait loci on porcine chromosome 4 ...


  • Site-specific cleavage of human chromosome-4 mediated by triple-helix formation
    Site-specific cleavage of human chromosome-4 mediated by triple-helix formation. S. A. Strobel, L. A. Doucettestamm, L. Riba, D. E. Housman and P. B. Dervan Science, 254, 1639-1642, (1991). Direct ...


  • Ensembl v33: Danio rerio Overview of Chromosome 4
    ... e.g. 21, 4 Ensembl v33 - Sep 2005 Help Chromosome 4 View Chromosome 4 Map your data onto this chromosome Use Ensembl to... Run a BLAST search Search Ensembl Data mining [BioMart] Upload your own data ...



  • ... Finder Intron Finder CAPS Designer Bulk Download Unigene & BAC Information Access FTP site Chromosome 4 (Click on one of the sidebars to view that region in detail) SGN is supported in part by the ...


  • Human Chromsome 4 and Mouse Chromosome 5
    [Home] [Help] Human chromosome 4 Mouse chromosome 5 Select other chromosomes Human Mouse 1 1 2 2 3 3 4 4 5 5 6 6 7 7 8 8 9 9 10 10 11 11 12 12 13 13 14 14 15 15 16 16 17 17 18 18 19 19 20 21 22


  • Functional Genomics of Plant Polyploids
    ... This microarray has 2000 1kb features from around the heterochromatic knob on chromosome 4, (http://www.cshl.org/protarab). It has been hybridized to 21 BAC clones from this portion of the chromosome ...


  • Chromosome 4
    Chromosome 4 Chr Position in a YAC physical map (genetic distance, cM) Marker name 1) Type of marker 2) Enzyme 3) Amplified band size (bp) in Nipponbare 5' primer sequence 3' primer sequence Mapping ...


  • Albumin
    ... H., et al (Genome Research 9: 581-587, 1999) have mapped the q11-q13 region of human chromosome 4 and redefined the order and transcriptional orientations of the four genes of the albumin superfamily ...


  • Sequence and analysis of chromosome 4 of the plant Arabidopsis thaliana
    http://www.nature.com/cgi ...full/402769a0_fs.html


  • http://www.flybase.org/seqs/lk/genomic/dmel-4-chromosome-r4.2.1.fasta
    >4 type=chromosome; loc=4:1..1281640; ID=4; release=r4.2.1; species=dmel GAATTCGCGTCCGCTTACCCATGTGCCTGTGGATGCCGAACAGGAGGCGC CGTTGACGGCGAATGACTTACTCAAGGGAGTAGCCAATCTGTCGGATACG ...


  • The Human Genome (first draft) - Chromosome 4
    Chromosome 4 Back to Chromosomes page Diseases Associated with Chromosome 4 HUNTINGTON DISEASE - is an inherited, degenerative neurological disease that leads to dementia. The HD gene, whose mutation ...


  • Current Medical Diagnosis & Treatment in Psychiatry
    ... Using these techniques, researchers have located genes, in specific regions of chromosomes, for many neuropsychiatric diseases: Huntingtons disease (chromosome 4), Friedreichs ataxia (chromosome 9 ...


  • Markers and Genes mapped on Chromosome 4
    Markers and Genes mapped on Chromosome 4 Last Update : 22th May, 2002 List of genes mapped on SSC 4, (List with links to GDB in US, or GDB in Germany). List of markers mapped on SSC 4 Chromosomal ...


  • Mesothelioma-Advisory.com - lawyer, attorney, law, lawsuit -
    http://www.mesothelioma-advisory.com/


  • Malaria IDC Database
    ... mitochondrial organellar translation Go to Chromosome Chromosome 1 Chromosome 2 Chromosome 3 Chromosome 4 Chromosome 5 Chromosome 6 Chromosome 7 Chromosome 8 Chromosome 9 Chromosome 10 Chromosome 11 ...


  • © The Centre for Genetics Education
    ... The FGFR3 gene is found on the short arm of chromosome 4. There is no cure for achondroplasia but symptoms are treated as they arise. 2. Short-trunk conditions Other skeletal dysplasias result in a ...


  • Resources for Chromosome 4 Narcolepsy
    Sponsored Links for chromosome 4 narcolepsy Who Else Wants to Discover the Secrets to a Perfect ... ... Chromosome 4 Narcolepsy Resources Additional Chromosome 4 Narcolepsy Resources Page: [1] [2] [3] [4 ...


  • Related Disorders
    ... SOFT. Chromosome 1 Charlene Jurysta 114 Whitetail Lane Butler PA 16001-0268 Phone: (724) 865-2397 Chromosome 4 Christine Kleimola 1109 Sherman Street Ypsilanti, MI 48197 Phone: (734) 482-4027 Email ...



  • CHROMOSOME 4 Return to Chromosome Maps Return to Genome Mapping Data Page Return to home page


  • ENSmutants | Mouse Line Dab1
    ... 6 34.2 cM See Also At the Jackson Site: JAX Stock 002043 Disabled homolog 1 (Drosophila) (Dab1) on chromosome 4 cM 52.7 Any links immediately below search for related mouse lines on this site, or ...


  • The Shoemaker And The Elves
    Remember the story of the Shoemaker and The Elves?

    The shoemaker would go to sleep and the elves would finish
    any shoes he hadn't gotten around to.

    Our minds function in much the same way, Our conscious,
    logical mind is the shoemaker. Our subconscious is the
    elves.

    Give your conscious mind a goal, gather all the facts and
    let the elves do their work.

    Many of our greatest inventions and discoveries have come
    after the scientist or researcher had given up and the
    elves took over.

    The structure of DNA had baffled researchers for years. Author:
    John Colanzi
    CLICK HERE TO READ THE REST OF THIS ARTICLE

     

  • Natural Acne Treatments
    At some point in your life you will probably suffer from acne. Almost everyone does. There has been a great deal of news about acne treatments recently with many claiming a combination of an acne prevention diet and some of the all natural acne treatments to be the answer. So you might want to try that route.

    Acne is a disorder of the sebaceous gland. This is the gland in the skin that secretes an oily substance to the face, neck, and back mostly. If the sebaceous gland becomes clogged with this oily substance you get a zit or a pimple. And sometimes you get a lot of them.

    There are many ...
    Author: Tanabanas
    CLICK HERE TO READ THE REST OF THIS ARTICLE

     

     

     

  •          
        Copyright Genetics Info 2005-2006    

    Partners & Resources